polystyrene 96 well plate (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
96
Structured Review
Thermo Fisher
polystyrene 96 well plate
Polystyrene 96 Well Plate, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/polystyrene+96+well+plates/Polystyrene+96-Well+Plate+Cover+with+Notches/10__1016_slash_j__surfcoat__2026__133405-149-10-14
Average 96 stars, based on 1 article reviews
Polystyrene 96 Well Plate, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/polystyrene+96+well+plates/Polystyrene+96-Well+Plate+Cover+with+Notches/10__1016_slash_j__surfcoat__2026__133405-149-10-14
Average 96 stars, based on 1 article reviews
polystyrene 96 well plate - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
other:Article Title: Regulation of Kv2.1 biogenesis and gating by candidate disease-linked Kv6.1 variants Article Snippet: A Nanoluc-Kv2.1 fusion protein (NanoLuc luciferase; BRET donor) was generated by PCR amplification with the following primers: Kv2.1-NotI-5′: gggggcggccgctaatgccggcgggcatgacg, Kv2.1-KpnI-stop-3′: ggggggtacctcagatgctctgatctcg, followed by ligation with compatible restriction sites NotI and KpnI using pcDNA3.1-ccdB-Nanoluc as the Nanoluc template (gift from Mikko Taipale, Addgene plasmid #87067). Protein Binding:Article Title: Chronic hypoxia has differential effects on constitutive and antigen-stimulated immune function in Atlantic salmon ( Salmo salar ) Article Snippet: .. Then, 100 μL of each sample was pipetted into triplicate wells of high protein-binding Cell Culture:Article Title: Use of genome-scale metabolic reconstructions of avian pathogenic Escherichia coli (APEC) phylogroups for the identification of lineage-specific metabolic pathways Article Snippet: .. The Fluorescence:Article Title: Lactococcal phage–host profiling through binding studies between cell wall polysaccharide types and Skunavirus receptor-binding proteins Article Snippet: .. Subsequently, the samples were transferred to black Article Title: Lactococcal phage-host profiling through binding studies between cell wall polysaccharide types and Skunavirus receptor-binding proteins. Article Snippet: .. Subsequently, the samples were transferred to black Transfection:Article Title: Regulation of Kv2.1 biogenesis and gating by candidate disease-linked Kv6.1 variants. Article Snippet: A Nanoluc-Kv2.1 fusion protein (NanoLuc luciferase; BRET donor) was generated by PCR amplification with the following primers: Kv2.1-NotI-5’: gggggcggccgctaatgccggcgggcatgacg, Kv2.1-KpnI-stop-3’: ggggggtacctcagatgctctgatctcg, followed by ligation with compatible restriction sites NotI and KpnI using pcDNA3.1-ccdB-Nanoluc as the Nanoluc template (gift from Mikko Taipale, Addgene plasmid #87067). mEGFP tagged at the N-terminus of Kv6.1 or the Kv6.1 variants was used as BRET acceptor. .. LM cells were transiently transfected with BRET donor and acceptor cDNAs for 48 hours, followed by replating onto white Bioluminescence Resonance Energy Transfer:Article Title: Regulation of Kv2.1 biogenesis and gating by candidate disease-linked Kv6.1 variants. Article Snippet: A Nanoluc-Kv2.1 fusion protein (NanoLuc luciferase; BRET donor) was generated by PCR amplification with the following primers: Kv2.1-NotI-5’: gggggcggccgctaatgccggcgggcatgacg, Kv2.1-KpnI-stop-3’: ggggggtacctcagatgctctgatctcg, followed by ligation with compatible restriction sites NotI and KpnI using pcDNA3.1-ccdB-Nanoluc as the Nanoluc template (gift from Mikko Taipale, Addgene plasmid #87067). mEGFP tagged at the N-terminus of Kv6.1 or the Kv6.1 variants was used as BRET acceptor. .. LM cells were transiently transfected with BRET donor and acceptor cDNAs for 48 hours, followed by replating onto white |